pGEX-4T-3 Plasmid Information
Alias: pgex4t3; pgex4t-3
TAC: promoter
Replicon: pBR322
Plasmid classification: Escherichia coli vector; pGEX series expression plasmid
Plasmid size: 4968 BP
Plasmid Tags: n-gst, n-thrombin
Prokaryotic resistance: amp
Clone strain: dh5a
Culture conditions: 37 degrees
Expression host: E.coli BL21 (DE3)
Culture conditions: 37 ℃, aerobic, lb
Induction method: IPTG or lactose and its analogues
5 'sequencing primer: pgex5: gggctggcaagccacgttgtggtg
3 'sequencing primer: pgex3: ccggaggtgcatgtcagagg
Note: GST affinity column can be used to purify recombinant protein
Plasmid host: Escherichia coli
Purpose of plasmid: protein expression
Fragment type: ORF
Fragment species: empty bodies
Prokaryotic resistance: amp
pGEX-4T-3 Plasmid Description
pGEX-4T-3 plasmid is a 4968 bp E.coli Expression Vector, which can be connected to the target gene through the enzyme cutting site at MCS, and tac promoter starts GST promoting labeling and target gene fusion expression.